ID: 962602356

View in Genome Browser
Species Human (GRCh38)
Location 3:137002842-137002864
Sequence ACCATTCAGGACATAGGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 27438
Summary {0: 13071, 1: 7716, 2: 3011, 3: 1777, 4: 1863}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962602356_962602361 -1 Left 962602356 3:137002842-137002864 CCCATGCCTATGTCCTGAATGGT 0: 13071
1: 7716
2: 3011
3: 1777
4: 1863
Right 962602361 3:137002864-137002886 TATTGCCTAGGTTTTCTTCTAGG 0: 8506
1: 11179
2: 4881
3: 2884
4: 2254
962602356_962602364 16 Left 962602356 3:137002842-137002864 CCCATGCCTATGTCCTGAATGGT 0: 13071
1: 7716
2: 3011
3: 1777
4: 1863
Right 962602364 3:137002881-137002903 TCTAGGACTTTTATGGCTTTAGG 0: 1
1: 35
2: 959
3: 14339
4: 7769
962602356_962602363 9 Left 962602356 3:137002842-137002864 CCCATGCCTATGTCCTGAATGGT 0: 13071
1: 7716
2: 3011
3: 1777
4: 1863
Right 962602363 3:137002874-137002896 GTTTTCTTCTAGGACTTTTATGG 0: 17
1: 979
2: 15216
3: 6154
4: 3042

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962602356 Original CRISPR ACCATTCAGGACATAGGCAT GGG (reversed) Intronic
Too many off-targets to display for this crispr