ID: 962602357

View in Genome Browser
Species Human (GRCh38)
Location 3:137002843-137002865
Sequence TACCATTCAGGACATAGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 25578
Summary {0: 13524, 1: 7516, 2: 2647, 3: 1163, 4: 728}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962602357_962602364 15 Left 962602357 3:137002843-137002865 CCATGCCTATGTCCTGAATGGTA 0: 13524
1: 7516
2: 2647
3: 1163
4: 728
Right 962602364 3:137002881-137002903 TCTAGGACTTTTATGGCTTTAGG 0: 1
1: 35
2: 959
3: 14339
4: 7769
962602357_962602361 -2 Left 962602357 3:137002843-137002865 CCATGCCTATGTCCTGAATGGTA 0: 13524
1: 7516
2: 2647
3: 1163
4: 728
Right 962602361 3:137002864-137002886 TATTGCCTAGGTTTTCTTCTAGG 0: 8506
1: 11179
2: 4881
3: 2884
4: 2254
962602357_962602363 8 Left 962602357 3:137002843-137002865 CCATGCCTATGTCCTGAATGGTA 0: 13524
1: 7516
2: 2647
3: 1163
4: 728
Right 962602363 3:137002874-137002896 GTTTTCTTCTAGGACTTTTATGG 0: 17
1: 979
2: 15216
3: 6154
4: 3042

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962602357 Original CRISPR TACCATTCAGGACATAGGCA TGG (reversed) Intronic
Too many off-targets to display for this crispr