ID: 962602358

View in Genome Browser
Species Human (GRCh38)
Location 3:137002848-137002870
Sequence GGCAATACCATTCAGGACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 28880
Summary {0: 8681, 1: 11646, 2: 4690, 3: 2246, 4: 1617}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962602358_962602364 10 Left 962602358 3:137002848-137002870 CCTATGTCCTGAATGGTATTGCC 0: 8681
1: 11646
2: 4690
3: 2246
4: 1617
Right 962602364 3:137002881-137002903 TCTAGGACTTTTATGGCTTTAGG 0: 1
1: 35
2: 959
3: 14339
4: 7769
962602358_962602361 -7 Left 962602358 3:137002848-137002870 CCTATGTCCTGAATGGTATTGCC 0: 8681
1: 11646
2: 4690
3: 2246
4: 1617
Right 962602361 3:137002864-137002886 TATTGCCTAGGTTTTCTTCTAGG 0: 8506
1: 11179
2: 4881
3: 2884
4: 2254
962602358_962602363 3 Left 962602358 3:137002848-137002870 CCTATGTCCTGAATGGTATTGCC 0: 8681
1: 11646
2: 4690
3: 2246
4: 1617
Right 962602363 3:137002874-137002896 GTTTTCTTCTAGGACTTTTATGG 0: 17
1: 979
2: 15216
3: 6154
4: 3042

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962602358 Original CRISPR GGCAATACCATTCAGGACAT AGG (reversed) Intronic
Too many off-targets to display for this crispr