ID: 962602360

View in Genome Browser
Species Human (GRCh38)
Location 3:137002855-137002877
Sequence AAACCTAGGCAATACCATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 30106
Summary {0: 8733, 1: 11767, 2: 5172, 3: 2689, 4: 1745}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962602360_962602363 -4 Left 962602360 3:137002855-137002877 CCTGAATGGTATTGCCTAGGTTT 0: 8733
1: 11767
2: 5172
3: 2689
4: 1745
Right 962602363 3:137002874-137002896 GTTTTCTTCTAGGACTTTTATGG 0: 17
1: 979
2: 15216
3: 6154
4: 3042
962602360_962602364 3 Left 962602360 3:137002855-137002877 CCTGAATGGTATTGCCTAGGTTT 0: 8733
1: 11767
2: 5172
3: 2689
4: 1745
Right 962602364 3:137002881-137002903 TCTAGGACTTTTATGGCTTTAGG 0: 1
1: 35
2: 959
3: 14339
4: 7769

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962602360 Original CRISPR AAACCTAGGCAATACCATTC AGG (reversed) Intronic
Too many off-targets to display for this crispr