ID: 962602364

View in Genome Browser
Species Human (GRCh38)
Location 3:137002881-137002903
Sequence TCTAGGACTTTTATGGCTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 23103
Summary {0: 1, 1: 35, 2: 959, 3: 14339, 4: 7769}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962602358_962602364 10 Left 962602358 3:137002848-137002870 CCTATGTCCTGAATGGTATTGCC 0: 8681
1: 11646
2: 4690
3: 2246
4: 1617
Right 962602364 3:137002881-137002903 TCTAGGACTTTTATGGCTTTAGG 0: 1
1: 35
2: 959
3: 14339
4: 7769
962602357_962602364 15 Left 962602357 3:137002843-137002865 CCATGCCTATGTCCTGAATGGTA 0: 13524
1: 7516
2: 2647
3: 1163
4: 728
Right 962602364 3:137002881-137002903 TCTAGGACTTTTATGGCTTTAGG 0: 1
1: 35
2: 959
3: 14339
4: 7769
962602356_962602364 16 Left 962602356 3:137002842-137002864 CCCATGCCTATGTCCTGAATGGT 0: 13071
1: 7716
2: 3011
3: 1777
4: 1863
Right 962602364 3:137002881-137002903 TCTAGGACTTTTATGGCTTTAGG 0: 1
1: 35
2: 959
3: 14339
4: 7769
962602354_962602364 21 Left 962602354 3:137002837-137002859 CCTTGCCCATGCCTATGTCCTGA 0: 10218
1: 5001
2: 1235
3: 356
4: 470
Right 962602364 3:137002881-137002903 TCTAGGACTTTTATGGCTTTAGG 0: 1
1: 35
2: 959
3: 14339
4: 7769
962602360_962602364 3 Left 962602360 3:137002855-137002877 CCTGAATGGTATTGCCTAGGTTT 0: 8733
1: 11767
2: 5172
3: 2689
4: 1745
Right 962602364 3:137002881-137002903 TCTAGGACTTTTATGGCTTTAGG 0: 1
1: 35
2: 959
3: 14339
4: 7769

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962602364 Original CRISPR TCTAGGACTTTTATGGCTTT AGG Intronic
Too many off-targets to display for this crispr