ID: 962605715

View in Genome Browser
Species Human (GRCh38)
Location 3:137031340-137031362
Sequence CTTTGGAAGGCTAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 205347
Summary {0: 3, 1: 234, 2: 5941, 3: 59931, 4: 139238}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962605715 Original CRISPR CTTTGGAAGGCTAAGGTGGA AGG (reversed) Intergenic
Too many off-targets to display for this crispr