ID: 962606402

View in Genome Browser
Species Human (GRCh38)
Location 3:137035996-137036018
Sequence TGGGCTATTCTCAGGCATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962606393_962606402 3 Left 962606393 3:137035970-137035992 CCCTTTTCTCAGTACCAATTCTA No data
Right 962606402 3:137035996-137036018 TGGGCTATTCTCAGGCATGGGGG No data
962606391_962606402 15 Left 962606391 3:137035958-137035980 CCTTGTGAGGTCCCCTTTTCTCA No data
Right 962606402 3:137035996-137036018 TGGGCTATTCTCAGGCATGGGGG No data
962606394_962606402 2 Left 962606394 3:137035971-137035993 CCTTTTCTCAGTACCAATTCTAG No data
Right 962606402 3:137035996-137036018 TGGGCTATTCTCAGGCATGGGGG No data
962606392_962606402 4 Left 962606392 3:137035969-137035991 CCCCTTTTCTCAGTACCAATTCT No data
Right 962606402 3:137035996-137036018 TGGGCTATTCTCAGGCATGGGGG No data
962606390_962606402 25 Left 962606390 3:137035948-137035970 CCTTTCTACGCCTTGTGAGGTCC No data
Right 962606402 3:137035996-137036018 TGGGCTATTCTCAGGCATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962606402 Original CRISPR TGGGCTATTCTCAGGCATGG GGG Intergenic
No off target data available for this crispr