ID: 962607575

View in Genome Browser
Species Human (GRCh38)
Location 3:137045258-137045280
Sequence CTGGAGTCTTGCTGTTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962607570_962607575 20 Left 962607570 3:137045215-137045237 CCTCTCAGAAATAACTTTGTGTA No data
Right 962607575 3:137045258-137045280 CTGGAGTCTTGCTGTTTTGTGGG No data
962607569_962607575 30 Left 962607569 3:137045205-137045227 CCTGCTGAGGCCTCTCAGAAATA No data
Right 962607575 3:137045258-137045280 CTGGAGTCTTGCTGTTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962607575 Original CRISPR CTGGAGTCTTGCTGTTTTGT GGG Intergenic
No off target data available for this crispr