ID: 962613849

View in Genome Browser
Species Human (GRCh38)
Location 3:137104533-137104555
Sequence CTGGGAGGCCACCACTCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962613849_962613855 -3 Left 962613849 3:137104533-137104555 CCTGCAGAGTGGTGGCCTCCCAG No data
Right 962613855 3:137104553-137104575 CAGAGAGGACAGGTACCCGCAGG No data
962613849_962613856 7 Left 962613849 3:137104533-137104555 CCTGCAGAGTGGTGGCCTCCCAG No data
Right 962613856 3:137104563-137104585 AGGTACCCGCAGGTAAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962613849 Original CRISPR CTGGGAGGCCACCACTCTGC AGG (reversed) Intergenic
No off target data available for this crispr