ID: 962615257

View in Genome Browser
Species Human (GRCh38)
Location 3:137120144-137120166
Sequence ACTAATAGACTGAAGGTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962615257_962615261 -3 Left 962615257 3:137120144-137120166 CCCTTTACCTTCAGTCTATTAGT No data
Right 962615261 3:137120164-137120186 AGTGTCTTTCCCAGTTAAGTGGG No data
962615257_962615264 18 Left 962615257 3:137120144-137120166 CCCTTTACCTTCAGTCTATTAGT No data
Right 962615264 3:137120185-137120207 GGTTTCTTATAAGCAGCATATGG No data
962615257_962615260 -4 Left 962615257 3:137120144-137120166 CCCTTTACCTTCAGTCTATTAGT No data
Right 962615260 3:137120163-137120185 TAGTGTCTTTCCCAGTTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962615257 Original CRISPR ACTAATAGACTGAAGGTAAA GGG (reversed) Intergenic
No off target data available for this crispr