ID: 962621797

View in Genome Browser
Species Human (GRCh38)
Location 3:137187550-137187572
Sequence CTGTTGTTGTTTCTGACAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962621791_962621797 9 Left 962621791 3:137187518-137187540 CCAGGAAGGATAGGTCTTCTAGG No data
Right 962621797 3:137187550-137187572 CTGTTGTTGTTTCTGACAAAGGG No data
962621790_962621797 15 Left 962621790 3:137187512-137187534 CCAGAGCCAGGAAGGATAGGTCT No data
Right 962621797 3:137187550-137187572 CTGTTGTTGTTTCTGACAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962621797 Original CRISPR CTGTTGTTGTTTCTGACAAA GGG Intergenic
No off target data available for this crispr