ID: 962626845

View in Genome Browser
Species Human (GRCh38)
Location 3:137234197-137234219
Sequence AAGGCTTAACTGGGGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962626845_962626854 15 Left 962626845 3:137234197-137234219 CCATCCTCCCCCAGTTAAGCCTT No data
Right 962626854 3:137234235-137234257 CCAGCCAACACCTTAACTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962626845 Original CRISPR AAGGCTTAACTGGGGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr