ID: 962626854

View in Genome Browser
Species Human (GRCh38)
Location 3:137234235-137234257
Sequence CCAGCCAACACCTTAACTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962626849_962626854 6 Left 962626849 3:137234206-137234228 CCCAGTTAAGCCTTGATATGACT No data
Right 962626854 3:137234235-137234257 CCAGCCAACACCTTAACTGTAGG No data
962626846_962626854 11 Left 962626846 3:137234201-137234223 CCTCCCCCAGTTAAGCCTTGATA No data
Right 962626854 3:137234235-137234257 CCAGCCAACACCTTAACTGTAGG No data
962626848_962626854 7 Left 962626848 3:137234205-137234227 CCCCAGTTAAGCCTTGATATGAC No data
Right 962626854 3:137234235-137234257 CCAGCCAACACCTTAACTGTAGG No data
962626847_962626854 8 Left 962626847 3:137234204-137234226 CCCCCAGTTAAGCCTTGATATGA No data
Right 962626854 3:137234235-137234257 CCAGCCAACACCTTAACTGTAGG No data
962626850_962626854 5 Left 962626850 3:137234207-137234229 CCAGTTAAGCCTTGATATGACTG No data
Right 962626854 3:137234235-137234257 CCAGCCAACACCTTAACTGTAGG No data
962626851_962626854 -4 Left 962626851 3:137234216-137234238 CCTTGATATGACTGTAGACCCAG No data
Right 962626854 3:137234235-137234257 CCAGCCAACACCTTAACTGTAGG No data
962626845_962626854 15 Left 962626845 3:137234197-137234219 CCATCCTCCCCCAGTTAAGCCTT No data
Right 962626854 3:137234235-137234257 CCAGCCAACACCTTAACTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962626854 Original CRISPR CCAGCCAACACCTTAACTGT AGG Intergenic
No off target data available for this crispr