ID: 962626871

View in Genome Browser
Species Human (GRCh38)
Location 3:137234383-137234405
Sequence CCTGATTAGAAGGTAGTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962626868_962626871 -9 Left 962626868 3:137234369-137234391 CCAAGGAAAGAACACCTGATTAG No data
Right 962626871 3:137234383-137234405 CCTGATTAGAAGGTAGTTTCAGG No data
962626866_962626871 20 Left 962626866 3:137234340-137234362 CCATAGGACTGAGTAAAAAGAGA No data
Right 962626871 3:137234383-137234405 CCTGATTAGAAGGTAGTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962626871 Original CRISPR CCTGATTAGAAGGTAGTTTC AGG Intergenic
No off target data available for this crispr