ID: 962626871 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:137234383-137234405 |
Sequence | CCTGATTAGAAGGTAGTTTC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
962626868_962626871 | -9 | Left | 962626868 | 3:137234369-137234391 | CCAAGGAAAGAACACCTGATTAG | No data | ||
Right | 962626871 | 3:137234383-137234405 | CCTGATTAGAAGGTAGTTTCAGG | No data | ||||
962626866_962626871 | 20 | Left | 962626866 | 3:137234340-137234362 | CCATAGGACTGAGTAAAAAGAGA | No data | ||
Right | 962626871 | 3:137234383-137234405 | CCTGATTAGAAGGTAGTTTCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
962626871 | Original CRISPR | CCTGATTAGAAGGTAGTTTC AGG | Intergenic | ||
No off target data available for this crispr |