ID: 962626993

View in Genome Browser
Species Human (GRCh38)
Location 3:137235648-137235670
Sequence GAGAACATGGGGAAGGAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962626982_962626993 21 Left 962626982 3:137235604-137235626 CCAACATGGGATTAAAATGTGGG No data
Right 962626993 3:137235648-137235670 GAGAACATGGGGAAGGAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962626993 Original CRISPR GAGAACATGGGGAAGGAGTT GGG Intergenic
No off target data available for this crispr