ID: 962629553

View in Genome Browser
Species Human (GRCh38)
Location 3:137262587-137262609
Sequence ATGATCAGGAGTAAATACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962629549_962629553 28 Left 962629549 3:137262536-137262558 CCATGTATCTGTCATATCATCAT No data
Right 962629553 3:137262587-137262609 ATGATCAGGAGTAAATACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962629553 Original CRISPR ATGATCAGGAGTAAATACAC AGG Intergenic
No off target data available for this crispr