ID: 962631195

View in Genome Browser
Species Human (GRCh38)
Location 3:137277762-137277784
Sequence CTAGCTCAGCACATCTTCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962631195_962631197 11 Left 962631195 3:137277762-137277784 CCTATGAAGATGTGCTGAGCTAG No data
Right 962631197 3:137277796-137277818 TTTAGAGTAGCAGTCAAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962631195 Original CRISPR CTAGCTCAGCACATCTTCAT AGG (reversed) Intergenic
No off target data available for this crispr