ID: 962631899

View in Genome Browser
Species Human (GRCh38)
Location 3:137285256-137285278
Sequence TGTTATTTATTTTCACTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962631899_962631902 16 Left 962631899 3:137285256-137285278 CCTTTAAGTGAAAATAAATAACA No data
Right 962631902 3:137285295-137285317 CTTTTCCCTCCTGTGAGTATTGG No data
962631899_962631901 -7 Left 962631899 3:137285256-137285278 CCTTTAAGTGAAAATAAATAACA No data
Right 962631901 3:137285272-137285294 AATAACAAAGAGTTTGGCGATGG No data
962631899_962631903 17 Left 962631899 3:137285256-137285278 CCTTTAAGTGAAAATAAATAACA No data
Right 962631903 3:137285296-137285318 TTTTCCCTCCTGTGAGTATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962631899 Original CRISPR TGTTATTTATTTTCACTTAA AGG (reversed) Intergenic
No off target data available for this crispr