ID: 962631901

View in Genome Browser
Species Human (GRCh38)
Location 3:137285272-137285294
Sequence AATAACAAAGAGTTTGGCGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962631898_962631901 15 Left 962631898 3:137285234-137285256 CCTGAAACATACAGATGTTTAAC No data
Right 962631901 3:137285272-137285294 AATAACAAAGAGTTTGGCGATGG No data
962631899_962631901 -7 Left 962631899 3:137285256-137285278 CCTTTAAGTGAAAATAAATAACA No data
Right 962631901 3:137285272-137285294 AATAACAAAGAGTTTGGCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962631901 Original CRISPR AATAACAAAGAGTTTGGCGA TGG Intergenic
No off target data available for this crispr