ID: 962631902

View in Genome Browser
Species Human (GRCh38)
Location 3:137285295-137285317
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962631899_962631902 16 Left 962631899 3:137285256-137285278 CCTTTAAGTGAAAATAAATAACA No data
Right 962631902 3:137285295-137285317 CTTTTCCCTCCTGTGAGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr