ID: 962634871

View in Genome Browser
Species Human (GRCh38)
Location 3:137319986-137320008
Sequence TGCGGCTCCCAGCAAGATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962634871_962634874 -1 Left 962634871 3:137319986-137320008 CCTTGATCTTGCTGGGAGCCGCA No data
Right 962634874 3:137320008-137320030 AGACCAGAGATGTTCCTGTTGGG No data
962634871_962634873 -2 Left 962634871 3:137319986-137320008 CCTTGATCTTGCTGGGAGCCGCA No data
Right 962634873 3:137320007-137320029 CAGACCAGAGATGTTCCTGTTGG No data
962634871_962634877 13 Left 962634871 3:137319986-137320008 CCTTGATCTTGCTGGGAGCCGCA No data
Right 962634877 3:137320022-137320044 CCTGTTGGGCCATCTTGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962634871 Original CRISPR TGCGGCTCCCAGCAAGATCA AGG (reversed) Intergenic
No off target data available for this crispr