ID: 962658549

View in Genome Browser
Species Human (GRCh38)
Location 3:137575574-137575596
Sequence TGTATATGGGTCATTCCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962658546_962658549 1 Left 962658546 3:137575550-137575572 CCAACTGATTTTAAAGCACAGTA No data
Right 962658549 3:137575574-137575596 TGTATATGGGTCATTCCTTTTGG No data
962658544_962658549 19 Left 962658544 3:137575532-137575554 CCACCAGAATAAATCATTCCAAC No data
Right 962658549 3:137575574-137575596 TGTATATGGGTCATTCCTTTTGG No data
962658545_962658549 16 Left 962658545 3:137575535-137575557 CCAGAATAAATCATTCCAACTGA No data
Right 962658549 3:137575574-137575596 TGTATATGGGTCATTCCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962658549 Original CRISPR TGTATATGGGTCATTCCTTT TGG Intergenic
No off target data available for this crispr