ID: 962658879

View in Genome Browser
Species Human (GRCh38)
Location 3:137580493-137580515
Sequence GGGAGCAAACAGACAGCCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962658879_962658883 22 Left 962658879 3:137580493-137580515 CCATAGGCTGTCTGTTTGCTCCC No data
Right 962658883 3:137580538-137580560 AGCAGCTGTTTCATTTAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962658879 Original CRISPR GGGAGCAAACAGACAGCCTA TGG (reversed) Intergenic
No off target data available for this crispr