ID: 962662081

View in Genome Browser
Species Human (GRCh38)
Location 3:137612459-137612481
Sequence GTCCTAAAGAACACTGGATC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962662081_962662086 8 Left 962662081 3:137612459-137612481 CCGGATCCAGTGTTCTTTAGGAC No data
Right 962662086 3:137612490-137612512 TTTCCTGGCATAACATTCCAGGG No data
962662081_962662085 7 Left 962662081 3:137612459-137612481 CCGGATCCAGTGTTCTTTAGGAC No data
Right 962662085 3:137612489-137612511 ATTTCCTGGCATAACATTCCAGG No data
962662081_962662090 28 Left 962662081 3:137612459-137612481 CCGGATCCAGTGTTCTTTAGGAC No data
Right 962662090 3:137612510-137612532 GGGAAGATTCCTTCCTTTATGGG No data
962662081_962662089 27 Left 962662081 3:137612459-137612481 CCGGATCCAGTGTTCTTTAGGAC No data
Right 962662089 3:137612509-137612531 AGGGAAGATTCCTTCCTTTATGG No data
962662081_962662083 -7 Left 962662081 3:137612459-137612481 CCGGATCCAGTGTTCTTTAGGAC No data
Right 962662083 3:137612475-137612497 TTAGGACGCAGCCAATTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962662081 Original CRISPR GTCCTAAAGAACACTGGATC CGG (reversed) Intergenic
No off target data available for this crispr