ID: 962665367

View in Genome Browser
Species Human (GRCh38)
Location 3:137648927-137648949
Sequence CAGTTTGAGCAAAGGTACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962665367_962665372 16 Left 962665367 3:137648927-137648949 CCTGTGTACCTTTGCTCAAACTG No data
Right 962665372 3:137648966-137648988 ACGTCAGGAAGCTGAGAGCAAGG No data
962665367_962665369 -7 Left 962665367 3:137648927-137648949 CCTGTGTACCTTTGCTCAAACTG No data
Right 962665369 3:137648943-137648965 CAAACTGTTCCTCTTCTTCTAGG No data
962665367_962665370 1 Left 962665367 3:137648927-137648949 CCTGTGTACCTTTGCTCAAACTG No data
Right 962665370 3:137648951-137648973 TCCTCTTCTTCTAGGACGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962665367 Original CRISPR CAGTTTGAGCAAAGGTACAC AGG (reversed) Intergenic
No off target data available for this crispr