ID: 962665369

View in Genome Browser
Species Human (GRCh38)
Location 3:137648943-137648965
Sequence CAAACTGTTCCTCTTCTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962665366_962665369 8 Left 962665366 3:137648912-137648934 CCATTCATGCTCTCTCCTGTGTA No data
Right 962665369 3:137648943-137648965 CAAACTGTTCCTCTTCTTCTAGG No data
962665364_962665369 28 Left 962665364 3:137648892-137648914 CCCATGTAGAACTCTGGGCTCCA No data
Right 962665369 3:137648943-137648965 CAAACTGTTCCTCTTCTTCTAGG No data
962665365_962665369 27 Left 962665365 3:137648893-137648915 CCATGTAGAACTCTGGGCTCCAT No data
Right 962665369 3:137648943-137648965 CAAACTGTTCCTCTTCTTCTAGG No data
962665367_962665369 -7 Left 962665367 3:137648927-137648949 CCTGTGTACCTTTGCTCAAACTG No data
Right 962665369 3:137648943-137648965 CAAACTGTTCCTCTTCTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962665369 Original CRISPR CAAACTGTTCCTCTTCTTCT AGG Intergenic
No off target data available for this crispr