ID: 962665370

View in Genome Browser
Species Human (GRCh38)
Location 3:137648951-137648973
Sequence TCCTCTTCTTCTAGGACGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962665368_962665370 -7 Left 962665368 3:137648935-137648957 CCTTTGCTCAAACTGTTCCTCTT No data
Right 962665370 3:137648951-137648973 TCCTCTTCTTCTAGGACGTCAGG No data
962665366_962665370 16 Left 962665366 3:137648912-137648934 CCATTCATGCTCTCTCCTGTGTA No data
Right 962665370 3:137648951-137648973 TCCTCTTCTTCTAGGACGTCAGG No data
962665367_962665370 1 Left 962665367 3:137648927-137648949 CCTGTGTACCTTTGCTCAAACTG No data
Right 962665370 3:137648951-137648973 TCCTCTTCTTCTAGGACGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962665370 Original CRISPR TCCTCTTCTTCTAGGACGTC AGG Intergenic
No off target data available for this crispr