ID: 962665371

View in Genome Browser
Species Human (GRCh38)
Location 3:137648952-137648974
Sequence TCCTGACGTCCTAGAAGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962665371_962665372 -9 Left 962665371 3:137648952-137648974 CCTCTTCTTCTAGGACGTCAGGA No data
Right 962665372 3:137648966-137648988 ACGTCAGGAAGCTGAGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962665371 Original CRISPR TCCTGACGTCCTAGAAGAAG AGG (reversed) Intergenic
No off target data available for this crispr