ID: 962665372

View in Genome Browser
Species Human (GRCh38)
Location 3:137648966-137648988
Sequence ACGTCAGGAAGCTGAGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962665368_962665372 8 Left 962665368 3:137648935-137648957 CCTTTGCTCAAACTGTTCCTCTT No data
Right 962665372 3:137648966-137648988 ACGTCAGGAAGCTGAGAGCAAGG No data
962665367_962665372 16 Left 962665367 3:137648927-137648949 CCTGTGTACCTTTGCTCAAACTG No data
Right 962665372 3:137648966-137648988 ACGTCAGGAAGCTGAGAGCAAGG No data
962665371_962665372 -9 Left 962665371 3:137648952-137648974 CCTCTTCTTCTAGGACGTCAGGA No data
Right 962665372 3:137648966-137648988 ACGTCAGGAAGCTGAGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962665372 Original CRISPR ACGTCAGGAAGCTGAGAGCA AGG Intergenic
No off target data available for this crispr