ID: 962667532

View in Genome Browser
Species Human (GRCh38)
Location 3:137670135-137670157
Sequence CTCAGTCAACACTTCTCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962667532_962667537 27 Left 962667532 3:137670135-137670157 CCAAGAGAGAAGTGTTGACTGAG No data
Right 962667537 3:137670185-137670207 GAACACAGGACACACTTGAAGGG No data
962667532_962667536 26 Left 962667532 3:137670135-137670157 CCAAGAGAGAAGTGTTGACTGAG No data
Right 962667536 3:137670184-137670206 TGAACACAGGACACACTTGAAGG No data
962667532_962667533 -1 Left 962667532 3:137670135-137670157 CCAAGAGAGAAGTGTTGACTGAG No data
Right 962667533 3:137670157-137670179 GATGACAGAGACTCAAATTCAGG No data
962667532_962667534 13 Left 962667532 3:137670135-137670157 CCAAGAGAGAAGTGTTGACTGAG No data
Right 962667534 3:137670171-137670193 AAATTCAGGTACCTGAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962667532 Original CRISPR CTCAGTCAACACTTCTCTCT TGG (reversed) Intergenic
No off target data available for this crispr