ID: 962669288

View in Genome Browser
Species Human (GRCh38)
Location 3:137689039-137689061
Sequence AACACTTGGTCTCAATTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962669288_962669293 21 Left 962669288 3:137689039-137689061 CCTCTAAATTGAGACCAAGTGTT No data
Right 962669293 3:137689083-137689105 TTCCAGTTATATGATCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962669288 Original CRISPR AACACTTGGTCTCAATTTAG AGG (reversed) Intergenic
No off target data available for this crispr