ID: 962669291

View in Genome Browser
Species Human (GRCh38)
Location 3:137689053-137689075
Sequence GATCAATGGTACCCAACACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962669291_962669296 25 Left 962669291 3:137689053-137689075 CCAAGTGTTGGGTACCATTGATC No data
Right 962669296 3:137689101-137689123 CCTGGCTCCAACTTTTTCTCTGG No data
962669291_962669293 7 Left 962669291 3:137689053-137689075 CCAAGTGTTGGGTACCATTGATC No data
Right 962669293 3:137689083-137689105 TTCCAGTTATATGATCTGCCTGG No data
962669291_962669297 26 Left 962669291 3:137689053-137689075 CCAAGTGTTGGGTACCATTGATC No data
Right 962669297 3:137689102-137689124 CTGGCTCCAACTTTTTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962669291 Original CRISPR GATCAATGGTACCCAACACT TGG (reversed) Intergenic
No off target data available for this crispr