ID: 962669292

View in Genome Browser
Species Human (GRCh38)
Location 3:137689067-137689089
Sequence ACTGGAAGAAGCATGATCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962669292_962669300 19 Left 962669292 3:137689067-137689089 CCATTGATCATGCTTCTTCCAGT No data
Right 962669300 3:137689109-137689131 CAACTTTTTCTCTGGGCTTAGGG No data
962669292_962669296 11 Left 962669292 3:137689067-137689089 CCATTGATCATGCTTCTTCCAGT No data
Right 962669296 3:137689101-137689123 CCTGGCTCCAACTTTTTCTCTGG No data
962669292_962669293 -7 Left 962669292 3:137689067-137689089 CCATTGATCATGCTTCTTCCAGT No data
Right 962669293 3:137689083-137689105 TTCCAGTTATATGATCTGCCTGG No data
962669292_962669302 21 Left 962669292 3:137689067-137689089 CCATTGATCATGCTTCTTCCAGT No data
Right 962669302 3:137689111-137689133 ACTTTTTCTCTGGGCTTAGGGGG No data
962669292_962669297 12 Left 962669292 3:137689067-137689089 CCATTGATCATGCTTCTTCCAGT No data
Right 962669297 3:137689102-137689124 CTGGCTCCAACTTTTTCTCTGGG No data
962669292_962669301 20 Left 962669292 3:137689067-137689089 CCATTGATCATGCTTCTTCCAGT No data
Right 962669301 3:137689110-137689132 AACTTTTTCTCTGGGCTTAGGGG No data
962669292_962669303 28 Left 962669292 3:137689067-137689089 CCATTGATCATGCTTCTTCCAGT No data
Right 962669303 3:137689118-137689140 CTCTGGGCTTAGGGGGATGAAGG No data
962669292_962669299 18 Left 962669292 3:137689067-137689089 CCATTGATCATGCTTCTTCCAGT No data
Right 962669299 3:137689108-137689130 CCAACTTTTTCTCTGGGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962669292 Original CRISPR ACTGGAAGAAGCATGATCAA TGG (reversed) Intergenic
No off target data available for this crispr