ID: 962669296

View in Genome Browser
Species Human (GRCh38)
Location 3:137689101-137689123
Sequence CCTGGCTCCAACTTTTTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962669294_962669296 -7 Left 962669294 3:137689085-137689107 CCAGTTATATGATCTGCCTGGCT No data
Right 962669296 3:137689101-137689123 CCTGGCTCCAACTTTTTCTCTGG No data
962669291_962669296 25 Left 962669291 3:137689053-137689075 CCAAGTGTTGGGTACCATTGATC No data
Right 962669296 3:137689101-137689123 CCTGGCTCCAACTTTTTCTCTGG No data
962669292_962669296 11 Left 962669292 3:137689067-137689089 CCATTGATCATGCTTCTTCCAGT No data
Right 962669296 3:137689101-137689123 CCTGGCTCCAACTTTTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962669296 Original CRISPR CCTGGCTCCAACTTTTTCTC TGG Intergenic
No off target data available for this crispr