ID: 962669297

View in Genome Browser
Species Human (GRCh38)
Location 3:137689102-137689124
Sequence CTGGCTCCAACTTTTTCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962669294_962669297 -6 Left 962669294 3:137689085-137689107 CCAGTTATATGATCTGCCTGGCT No data
Right 962669297 3:137689102-137689124 CTGGCTCCAACTTTTTCTCTGGG No data
962669291_962669297 26 Left 962669291 3:137689053-137689075 CCAAGTGTTGGGTACCATTGATC No data
Right 962669297 3:137689102-137689124 CTGGCTCCAACTTTTTCTCTGGG No data
962669292_962669297 12 Left 962669292 3:137689067-137689089 CCATTGATCATGCTTCTTCCAGT No data
Right 962669297 3:137689102-137689124 CTGGCTCCAACTTTTTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962669297 Original CRISPR CTGGCTCCAACTTTTTCTCT GGG Intergenic
No off target data available for this crispr