ID: 962676423

View in Genome Browser
Species Human (GRCh38)
Location 3:137761706-137761728
Sequence TTGAATAAACCGGTGGTCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962676418_962676423 -1 Left 962676418 3:137761684-137761706 CCCGCCACAGCTCTAAAGAGTGT No data
Right 962676423 3:137761706-137761728 TTGAATAAACCGGTGGTCACCGG No data
962676414_962676423 24 Left 962676414 3:137761659-137761681 CCCCAGGATCACGGGAACTCCTG No data
Right 962676423 3:137761706-137761728 TTGAATAAACCGGTGGTCACCGG No data
962676419_962676423 -2 Left 962676419 3:137761685-137761707 CCGCCACAGCTCTAAAGAGTGTT No data
Right 962676423 3:137761706-137761728 TTGAATAAACCGGTGGTCACCGG No data
962676417_962676423 5 Left 962676417 3:137761678-137761700 CCTGCTCCCGCCACAGCTCTAAA No data
Right 962676423 3:137761706-137761728 TTGAATAAACCGGTGGTCACCGG No data
962676416_962676423 22 Left 962676416 3:137761661-137761683 CCAGGATCACGGGAACTCCTGCT No data
Right 962676423 3:137761706-137761728 TTGAATAAACCGGTGGTCACCGG No data
962676420_962676423 -5 Left 962676420 3:137761688-137761710 CCACAGCTCTAAAGAGTGTTGAA No data
Right 962676423 3:137761706-137761728 TTGAATAAACCGGTGGTCACCGG No data
962676413_962676423 29 Left 962676413 3:137761654-137761676 CCAGACCCCAGGATCACGGGAAC No data
Right 962676423 3:137761706-137761728 TTGAATAAACCGGTGGTCACCGG No data
962676415_962676423 23 Left 962676415 3:137761660-137761682 CCCAGGATCACGGGAACTCCTGC No data
Right 962676423 3:137761706-137761728 TTGAATAAACCGGTGGTCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962676423 Original CRISPR TTGAATAAACCGGTGGTCAC CGG Intergenic
No off target data available for this crispr