ID: 962678763

View in Genome Browser
Species Human (GRCh38)
Location 3:137777053-137777075
Sequence CTTGTTCTCCTGCGCTTAAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962678761_962678763 -7 Left 962678761 3:137777037-137777059 CCTGAAAGTCCTATGTCTTGTTC No data
Right 962678763 3:137777053-137777075 CTTGTTCTCCTGCGCTTAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962678763 Original CRISPR CTTGTTCTCCTGCGCTTAAT CGG Intergenic
No off target data available for this crispr