ID: 962679412

View in Genome Browser
Species Human (GRCh38)
Location 3:137783207-137783229
Sequence GTTGGAACCTAGAATTATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962679412_962679423 24 Left 962679412 3:137783207-137783229 CCCTTATAATTCTAGGTTCCAAC No data
Right 962679423 3:137783254-137783276 TCCATCTGAGGCAGTAGGGATGG No data
962679412_962679422 20 Left 962679412 3:137783207-137783229 CCCTTATAATTCTAGGTTCCAAC No data
Right 962679422 3:137783250-137783272 TCACTCCATCTGAGGCAGTAGGG No data
962679412_962679421 19 Left 962679412 3:137783207-137783229 CCCTTATAATTCTAGGTTCCAAC No data
Right 962679421 3:137783249-137783271 TTCACTCCATCTGAGGCAGTAGG No data
962679412_962679419 12 Left 962679412 3:137783207-137783229 CCCTTATAATTCTAGGTTCCAAC No data
Right 962679419 3:137783242-137783264 CCCTTTGTTCACTCCATCTGAGG No data
962679412_962679425 28 Left 962679412 3:137783207-137783229 CCCTTATAATTCTAGGTTCCAAC No data
Right 962679425 3:137783258-137783280 TCTGAGGCAGTAGGGATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962679412 Original CRISPR GTTGGAACCTAGAATTATAA GGG (reversed) Intergenic
No off target data available for this crispr