ID: 962679530

View in Genome Browser
Species Human (GRCh38)
Location 3:137783993-137784015
Sequence CCGGGAGGATACACGAAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962679523_962679530 15 Left 962679523 3:137783955-137783977 CCTTTATGCTCTTGGAACTATCA No data
Right 962679530 3:137783993-137784015 CCGGGAGGATACACGAAGTCAGG No data
962679522_962679530 16 Left 962679522 3:137783954-137783976 CCCTTTATGCTCTTGGAACTATC No data
Right 962679530 3:137783993-137784015 CCGGGAGGATACACGAAGTCAGG No data
962679516_962679530 30 Left 962679516 3:137783940-137783962 CCCTCCCATTCTTCCCCTTTATG No data
Right 962679530 3:137783993-137784015 CCGGGAGGATACACGAAGTCAGG No data
962679527_962679530 -8 Left 962679527 3:137783978-137784000 CCAGTAGCTTGGAAACCGGGAGG No data
Right 962679530 3:137783993-137784015 CCGGGAGGATACACGAAGTCAGG No data
962679518_962679530 26 Left 962679518 3:137783944-137783966 CCCATTCTTCCCCTTTATGCTCT No data
Right 962679530 3:137783993-137784015 CCGGGAGGATACACGAAGTCAGG No data
962679521_962679530 17 Left 962679521 3:137783953-137783975 CCCCTTTATGCTCTTGGAACTAT No data
Right 962679530 3:137783993-137784015 CCGGGAGGATACACGAAGTCAGG No data
962679517_962679530 29 Left 962679517 3:137783941-137783963 CCTCCCATTCTTCCCCTTTATGC No data
Right 962679530 3:137783993-137784015 CCGGGAGGATACACGAAGTCAGG No data
962679519_962679530 25 Left 962679519 3:137783945-137783967 CCATTCTTCCCCTTTATGCTCTT No data
Right 962679530 3:137783993-137784015 CCGGGAGGATACACGAAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962679530 Original CRISPR CCGGGAGGATACACGAAGTC AGG Intergenic
No off target data available for this crispr