ID: 962680635

View in Genome Browser
Species Human (GRCh38)
Location 3:137796163-137796185
Sequence CTCAAACCCCACCACTGAAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 168}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962680635_962680640 3 Left 962680635 3:137796163-137796185 CCGTTTCAGTGGTGGGGTTTGAG 0: 1
1: 0
2: 0
3: 13
4: 168
Right 962680640 3:137796189-137796211 AGTACTCTGGGACCCAGCCTGGG 0: 1
1: 0
2: 2
3: 23
4: 233
962680635_962680639 2 Left 962680635 3:137796163-137796185 CCGTTTCAGTGGTGGGGTTTGAG 0: 1
1: 0
2: 0
3: 13
4: 168
Right 962680639 3:137796188-137796210 GAGTACTCTGGGACCCAGCCTGG 0: 1
1: 0
2: 1
3: 15
4: 194
962680635_962680643 18 Left 962680635 3:137796163-137796185 CCGTTTCAGTGGTGGGGTTTGAG 0: 1
1: 0
2: 0
3: 13
4: 168
Right 962680643 3:137796204-137796226 AGCCTGGGTTTCACAGAACTAGG 0: 1
1: 0
2: 1
3: 13
4: 192
962680635_962680638 -9 Left 962680635 3:137796163-137796185 CCGTTTCAGTGGTGGGGTTTGAG 0: 1
1: 0
2: 0
3: 13
4: 168
Right 962680638 3:137796177-137796199 GGGTTTGAGGTGAGTACTCTGGG 0: 1
1: 0
2: 0
3: 5
4: 132
962680635_962680637 -10 Left 962680635 3:137796163-137796185 CCGTTTCAGTGGTGGGGTTTGAG 0: 1
1: 0
2: 0
3: 13
4: 168
Right 962680637 3:137796176-137796198 GGGGTTTGAGGTGAGTACTCTGG 0: 1
1: 0
2: 0
3: 7
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962680635 Original CRISPR CTCAAACCCCACCACTGAAA CGG (reversed) Intergenic
900910573 1:5594325-5594347 CTCAAATCCCACCCCTGCCAGGG + Intergenic
901542263 1:9926381-9926403 ATGCAACTCCACCACTGAAATGG - Intronic
907652737 1:56311339-56311361 CTGGAACCCCAGCACTGGAAGGG + Intergenic
912628377 1:111225340-111225362 CTCAAACCCCACCATGGAAGAGG - Intronic
913399920 1:118420743-118420765 CTCAAAGCACACAACTAAAATGG + Intergenic
914816528 1:151067052-151067074 CTCCAATCCCACCAGTAAAAAGG - Intronic
915026632 1:152836937-152836959 CTCAAACACTACCCTTGAAAAGG - Intergenic
915411516 1:155704541-155704563 CTGAAATCCCACAAGTGAAAAGG + Intronic
915719883 1:157977167-157977189 CTCCAACCCCACCCCTTACAGGG - Intergenic
917024493 1:170627401-170627423 CTCATCCCCCACCACCAAAAGGG + Intergenic
917054437 1:170964323-170964345 CTGAAACCTCACTCCTGAAAAGG + Intronic
918590953 1:186240495-186240517 CTCAAGCCCCCCATCTGAAAAGG - Intergenic
918660253 1:187079368-187079390 CTCAAAACCCTCAGCTGAAAGGG + Intergenic
919505412 1:198392061-198392083 CTCAAATCCCACAACAGAATAGG + Intergenic
920601501 1:207329287-207329309 CTCAAACCCCACATTTTAAAAGG - Intronic
921374745 1:214462191-214462213 CACAAACCCCACCTCAGCAATGG + Intronic
922085498 1:222343177-222343199 CTCAAACTCCACCCATAAAAGGG - Intergenic
923363419 1:233235246-233235268 CACAAACTCCAAGACTGAAAGGG + Intronic
924487302 1:244497920-244497942 CTCATACATCACCACTGAGAGGG + Intronic
924498360 1:244612129-244612151 CTTAAAGCTTACCACTGAAAGGG + Intronic
924548360 1:245051388-245051410 CTCAATCCCCCCCACCCAAAAGG + Intronic
1067096016 10:43300653-43300675 CTGGAAACCCACCCCTGAAACGG + Intergenic
1068791188 10:61033245-61033267 TTCACTCCCCTCCACTGAAATGG + Intergenic
1069128872 10:64673826-64673848 TTCATACCTCATCACTGAAAAGG + Intergenic
1070160002 10:73860607-73860629 CTCACACCCCAGCCCTGAGAAGG + Intronic
1072289694 10:93952627-93952649 CTCAGATCCCACAAGTGAAAAGG + Intronic
1072984977 10:100131328-100131350 CTCGAACCCCAGGACTCAAATGG - Intergenic
1074261518 10:111858195-111858217 CTCCAACCACATCCCTGAAAAGG + Intergenic
1074562512 10:114546601-114546623 CTGAAACACCTGCACTGAAAGGG - Intronic
1076273124 10:129174070-129174092 GTCAAACTCCCCCACTAAAATGG + Intergenic
1077219109 11:1407545-1407567 CTCAGACCCCACCTCTGCAGGGG + Intronic
1077436872 11:2545314-2545336 CACAAACTCCACCTCTAAAAGGG - Intronic
1077509292 11:2947787-2947809 TTCAAACCCCACCTTTTAAATGG - Intronic
1077736179 11:4794076-4794098 ATCAAATCCAACCACAGAAAAGG + Intronic
1079461015 11:20677923-20677945 CCCAAAGCCCACCACTGGAAAGG - Exonic
1079504918 11:21142689-21142711 CCCAAACCACACCACAGAATTGG - Intronic
1079551587 11:21705538-21705560 CTAAAACCCCACCAGGAAAAAGG - Intergenic
1080890654 11:36406211-36406233 CCCTAACCCCAACACTGGAAAGG - Intronic
1088949514 11:114553105-114553127 CTCAAACCCAAACAATGAATAGG - Intronic
1090185467 11:124736742-124736764 CTCCACCCCCTCCACTCAAATGG + Intergenic
1090253767 11:125268829-125268851 CTCAGCCCCCACCCCAGAAAGGG - Intronic
1090358083 11:126153969-126153991 CTCATCCCCCACCACTGTAGGGG - Intergenic
1092774140 12:11927663-11927685 CTCAGAGCCCACCACGGAAGGGG - Intergenic
1093138480 12:15479280-15479302 CTCAAACCCCAACATGGAATTGG + Intronic
1094361390 12:29635022-29635044 CTCAAACCCCAACAAAGACATGG + Intronic
1095278860 12:40325981-40326003 CTCAAATCACACCACTGAAGTGG - Intronic
1096134030 12:49184820-49184842 TTCAAAACCCATCACAGAAATGG + Exonic
1096833334 12:54331558-54331580 CTAAAACCACACAACAGAAAAGG - Intronic
1102863356 12:116355266-116355288 ATCAAACCTCACCACTTGAAAGG + Intergenic
1106504604 13:30360341-30360363 CCACAACCCCACCCCTGAAATGG - Intergenic
1106597778 13:31161562-31161584 GTCCAACCCCACCACCGACATGG + Exonic
1106996123 13:35483403-35483425 CTCAATTCCTACCACTCAAAGGG - Intronic
1107016152 13:35709106-35709128 CTCAGTCCTTACCACTGAAAAGG - Intergenic
1108467275 13:50728924-50728946 CCCAAACCTCACCCCTGTAAAGG - Intronic
1111047529 13:82834246-82834268 TACAAACCCCACTGCTGAAAAGG + Intergenic
1111582116 13:90235947-90235969 CTCAAATCCTTCCACTTAAAGGG + Intergenic
1113530676 13:111023267-111023289 GTCAGACCCCACCACTGTGATGG - Intergenic
1114260392 14:21032427-21032449 CTCCACCCCCACCCCTCAAAAGG + Intronic
1116784577 14:49273196-49273218 CTCCAACCACATCCCTGAAAAGG + Intergenic
1116867869 14:50045846-50045868 CTCAAAACTCAGAACTGAAATGG + Intergenic
1120828938 14:88981034-88981056 CCCCGACCCCACCACGGAAAAGG + Intergenic
1121018063 14:90560511-90560533 CTGAATCCTCAACACTGAAAAGG - Intronic
1121572120 14:94954291-94954313 CTTAAACACCACCTGTGAAAGGG - Intergenic
1121953101 14:98189328-98189350 CTCACACCCCTCCACAGCAAGGG - Intergenic
1126337135 15:47598371-47598393 CTAAAACCAAAACACTGAAATGG - Intronic
1132304483 15:100801541-100801563 TTCAGATCCCATCACTGAAAAGG - Intergenic
1137696223 16:50463785-50463807 CCCAAACCCCAGGACTGGAATGG - Intergenic
1137996335 16:53218393-53218415 ACCTAACCCCACCACTCAAAAGG + Intronic
1140334392 16:74091052-74091074 TTAAAACCACACTACTGAAAAGG + Intergenic
1141056164 16:80816610-80816632 CTGAAGCTCCACCACGGAAAAGG + Intergenic
1143917816 17:10306901-10306923 TCCAAACCCCATCTCTGAAAAGG + Intronic
1145325714 17:21822575-21822597 CTCAAACCCAAACAATGAATAGG - Intergenic
1149503759 17:57175633-57175655 CTGGAACCCCAACACTGAATTGG + Intergenic
1152265159 17:79289925-79289947 CTCCAACCCTACCCCTAAAATGG + Intronic
1154280655 18:12999766-12999788 CCCAAACCTACCCACTGAAAAGG - Intronic
1155241236 18:23865636-23865658 CCCAGACCCCAGCACTGAGAGGG - Intronic
1156286667 18:35703593-35703615 CTCAAATGCCACCACCTAAAAGG + Exonic
1157452850 18:47801202-47801224 CTCCAACCCCCCCACTGCAGGGG + Intergenic
1159772027 18:72557748-72557770 CCCGCACCCCACCTCTGAAAAGG - Intronic
1160113935 18:76059263-76059285 CTAATACCCTACCACAGAAAGGG + Intergenic
1160495984 18:79375705-79375727 CTCAGCCCCTACAACTGAAAAGG - Intronic
1161010294 19:1956614-1956636 GTCAACACCAACCACTGAAAGGG - Intronic
1161313477 19:3607324-3607346 CTCCCACCCCACCCCTGGAAGGG - Intergenic
1163935702 19:20441249-20441271 TGCAACCCCTACCACTGAAAAGG - Intergenic
1165152108 19:33766941-33766963 CTCAAACTCCACCACAGACAGGG + Intronic
1165934764 19:39382678-39382700 CTCAAACCACACTTCTCAAAAGG - Intronic
1166939544 19:46354436-46354458 CAGAAAACCCACCACTGAATAGG + Intronic
1168390740 19:56005860-56005882 CTCAACCCCACCCAGTGAAATGG + Intronic
925186739 2:1852136-1852158 CTCAGACCCCAGCACTGCAAAGG + Intronic
925270571 2:2604285-2604307 CACACACCCCAACACAGAAATGG - Intergenic
927760997 2:25753763-25753785 CTCAAACCTCCTCACTGTAAAGG + Intronic
931624471 2:64244336-64244358 CTCAAACCCCACAAATGTTAGGG - Intergenic
936079825 2:109424381-109424403 CTGAAGCCCCACCACTGGACAGG - Intronic
937251940 2:120529427-120529449 CTTGAAGCCCACCACTTAAATGG + Intergenic
937358383 2:121212478-121212500 CCCGCACCCCACCACTGAATGGG + Intergenic
937776130 2:125777839-125777861 CTCAAATCCCACCATATAAAGGG - Intergenic
940928508 2:159396408-159396430 CACATACACCACCAATGAAATGG + Intronic
942701331 2:178714461-178714483 TTTGAACCACACCACTGAAATGG + Exonic
943055210 2:182968849-182968871 CTCAAACCCTACCATGGCAAGGG + Intronic
943650737 2:190455087-190455109 CTCCAACTCCACCACTCAGAAGG - Intronic
944297357 2:198081748-198081770 CTAAAACCCTACCCATGAAAAGG - Intronic
944738415 2:202589260-202589282 CCCAGAGCCCTCCACTGAAACGG + Intergenic
944777136 2:202978283-202978305 CCCAATCCACGCCACTGAAATGG - Intronic
944949763 2:204734850-204734872 CTCAAACTTTACCACTGAAATGG + Intronic
1169560103 20:6790611-6790633 CTCAAACCCAGCTACTGAAAGGG + Intergenic
1174366379 20:50059077-50059099 CTCCCACCCCACCTCTGAACTGG + Intergenic
1174677209 20:52369942-52369964 CTCCAACCCCAACCCTGACAAGG - Intergenic
1175710497 20:61216757-61216779 CTCTAACCCCACCATTGCTATGG + Intergenic
1177965747 21:27724716-27724738 CACAAGCTCAACCACTGAAATGG - Intergenic
1179768320 21:43592227-43592249 CTCAAAAGCCACCACAGCAAAGG + Exonic
1182130746 22:27848779-27848801 CTCGAACCCCAGGACTCAAAAGG + Intergenic
1183135412 22:35882363-35882385 TTGCAACCACACCACTGAAAGGG - Intronic
1183236191 22:36619958-36619980 GGCAAACTCCAGCACTGAAATGG + Intronic
1184943864 22:47787288-47787310 CTCAAATCAAACCACTAAAACGG + Intergenic
950219853 3:11186123-11186145 CTCAGAGCCCAGCATTGAAAGGG - Intronic
950333192 3:12173587-12173609 CTCCAACCATCCCACTGAAATGG + Intronic
952774846 3:37035382-37035404 CTCAGACCCCTCCACTGACTGGG + Intronic
952780405 3:37091677-37091699 CCCACTCCCAACCACTGAAAAGG + Intronic
953703401 3:45213645-45213667 CTCTGACCACCCCACTGAAATGG - Intergenic
957235134 3:77577824-77577846 ATTAAACCACACCAGTGAAATGG + Intronic
957820302 3:85364061-85364083 CTATAACCCCTCCACTAAAATGG + Intronic
960937237 3:122911685-122911707 CTCAGACCCCACCTCTGAGAAGG + Intronic
961967030 3:130915832-130915854 CTAAAACCACACTACTGAAGTGG - Intronic
962680635 3:137796163-137796185 CTCAAACCCCACCACTGAAACGG - Intergenic
964644641 3:158945954-158945976 CTGAAAACCAACAACTGAAAAGG + Intergenic
966646624 3:182252728-182252750 CTCATTCCCCTTCACTGAAAGGG + Intergenic
968680188 4:1913335-1913357 CTCTAACTCCCCCACGGAAAGGG - Intronic
968849582 4:3069845-3069867 CTCCAGCCCCACCCCTGAGAGGG - Intergenic
969663885 4:8545787-8545809 CTCTTACCCCACCCCTGGAAGGG - Intergenic
970192730 4:13530817-13530839 CTCAAATTCCACCTCTCAAAGGG + Intergenic
972690621 4:41394320-41394342 CTTAAACCCTTCCAATGAAAAGG + Intronic
976796685 4:88941667-88941689 CCCACCCCCCACCACTTAAAGGG - Intronic
977221730 4:94345380-94345402 CCCAAACCCAACCACAGAAAAGG - Intergenic
978884663 4:113752898-113752920 CTCAATCCCCCACACTGCAATGG + Intronic
979651578 4:123138950-123138972 CTCAAACCTTACCAGTGAAATGG + Intronic
981149218 4:141362018-141362040 CTCAACCCCCACCCCTGAATAGG - Intergenic
981944065 4:150320184-150320206 CTCAAACTCCGCCACTGACTGGG + Intronic
986282156 5:6332323-6332345 CTCAAACCCTACCAGTGGGAAGG + Intergenic
987692365 5:21283456-21283478 CTGGAAACCCACCCCTGAAACGG + Intergenic
988254782 5:28808235-28808257 CTCTAACCCCAGCACTTTAAGGG - Intergenic
990582014 5:57174264-57174286 CTCAAACCCCAACACGGACACGG - Intronic
991260524 5:64662779-64662801 CTCAAATACCACCATTGCAATGG + Intergenic
991799568 5:70346442-70346464 CTGGAAACCCACCCCTGAAACGG - Intergenic
991829029 5:70663596-70663618 CTGGAAACCCACCCCTGAAACGG + Intergenic
991891927 5:71345871-71345893 CTGGAAACCCACCCCTGAAACGG - Intergenic
992791566 5:80218827-80218849 CACAAACCACATCACAGAAAGGG + Intronic
993563651 5:89444971-89444993 CTCCACCACCACCAATGAAAAGG + Intergenic
996193766 5:120578395-120578417 CTCAACCTCCACCCCCGAAAAGG + Intronic
996874042 5:128222187-128222209 CTGGAAACCCACCCCTGAAATGG + Intergenic
997621196 5:135297345-135297367 CTCCACCCCCACCCCTGAATAGG + Intronic
997721342 5:136080523-136080545 CTCGAACCCCAGCACAGAGATGG + Intergenic
998712578 5:144843542-144843564 GGCAAACCCTACAACTGAAAAGG - Intergenic
1000119041 5:158179307-158179329 CTCAAACACCAGCACTGACCTGG + Intergenic
1000479447 5:161753481-161753503 CTGAAACCCCTCCATAGAAAAGG - Intergenic
1001188046 5:169596273-169596295 CTGAAAGCACACCACTGAACTGG - Intronic
1007075781 6:39065333-39065355 CTCAAATCACACTACTGACAAGG - Intronic
1010896943 6:81376491-81376513 CTCATCCCCCACCACCCAAAAGG - Intergenic
1012214831 6:96570522-96570544 CACAACCCCCACCACTAAATTGG + Intronic
1013961454 6:115905767-115905789 TTTAAAGCCCAACACTGAAACGG + Intergenic
1014977863 6:127911684-127911706 CCCAAACCCCACAACTGGAGTGG - Intronic
1016684516 6:146866268-146866290 CTCAAACTGAACCACTCAAAAGG + Intergenic
1017946885 6:159103471-159103493 CTCTAACCACACCCCTTAAAGGG + Intergenic
1018407901 6:163506844-163506866 CTTAAAACACAACACTGAAAGGG - Intronic
1023023095 7:36028187-36028209 CTCAACTTCCACAACTGAAAAGG + Intergenic
1023968109 7:44973821-44973843 CTCTTACCTCCCCACTGAAATGG - Intronic
1025320722 7:58090562-58090584 CTCCTACCCCACCACTACAAAGG + Intergenic
1027486119 7:78763778-78763800 CTAAAACCCAACCACTTAAATGG + Intronic
1027774506 7:82446906-82446928 GGCAAACCCAAACACTGAAAAGG + Intergenic
1028539648 7:91927782-91927804 CTCAGACCGCACCACTGCACTGG + Intergenic
1029162809 7:98564599-98564621 CTCAACCCCCAGCACGGGAATGG + Intergenic
1034708495 7:153170127-153170149 CTCTCACACCACCACTGAACAGG - Intergenic
1038006309 8:23433263-23433285 CTGCAACCCTACCTCTGAAATGG + Intronic
1038809932 8:30829895-30829917 CTAAAACTACCCCACTGAAAAGG + Intergenic
1039550206 8:38437909-38437931 CCCAAACCCCACAACTTAACAGG + Intronic
1043520232 8:81037131-81037153 ATTAAACCACACCACTGAAGAGG - Intronic
1044685761 8:94823825-94823847 CTAAAACCCCAACAGTAAAAAGG - Intronic
1052166734 9:25339495-25339517 CTAAAGCCCCACCACTTGAAAGG - Intergenic
1058529088 9:105888377-105888399 CTCAAACCTCACCAAGGATAAGG - Intergenic
1186394774 X:9196513-9196535 GCCAAAACTCACCACTGAAAGGG + Intergenic
1187475422 X:19606720-19606742 CTCAGACCCCACCCCAGACATGG - Intronic
1190047472 X:47124199-47124221 CTCAAACTCCTCCACTCAAGAGG - Intergenic
1196354511 X:114774836-114774858 CTCAAGGCCCATCACTGAAGAGG - Intronic