ID: 962680884

View in Genome Browser
Species Human (GRCh38)
Location 3:137799191-137799213
Sequence ACTTCTGAGAAACTGAATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962680880_962680884 11 Left 962680880 3:137799157-137799179 CCAACATTTATTGAACTACCTGA No data
Right 962680884 3:137799191-137799213 ACTTCTGAGAAACTGAATTAAGG No data
962680881_962680884 -7 Left 962680881 3:137799175-137799197 CCTGACTTCCTCCAAAACTTCTG No data
Right 962680884 3:137799191-137799213 ACTTCTGAGAAACTGAATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962680884 Original CRISPR ACTTCTGAGAAACTGAATTA AGG Intergenic
No off target data available for this crispr