ID: 962685104

View in Genome Browser
Species Human (GRCh38)
Location 3:137840065-137840087
Sequence GTTCCTAGTGGACCACGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962685098_962685104 -4 Left 962685098 3:137840046-137840068 CCTCTGGCCATGTGGCCCAGTTC No data
Right 962685104 3:137840065-137840087 GTTCCTAGTGGACCACGGACTGG No data
962685097_962685104 3 Left 962685097 3:137840039-137840061 CCGCTCACCTCTGGCCATGTGGC No data
Right 962685104 3:137840065-137840087 GTTCCTAGTGGACCACGGACTGG No data
962685094_962685104 7 Left 962685094 3:137840035-137840057 CCCACCGCTCACCTCTGGCCATG No data
Right 962685104 3:137840065-137840087 GTTCCTAGTGGACCACGGACTGG No data
962685095_962685104 6 Left 962685095 3:137840036-137840058 CCACCGCTCACCTCTGGCCATGT No data
Right 962685104 3:137840065-137840087 GTTCCTAGTGGACCACGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962685104 Original CRISPR GTTCCTAGTGGACCACGGAC TGG Intergenic
No off target data available for this crispr