ID: 962686040

View in Genome Browser
Species Human (GRCh38)
Location 3:137848484-137848506
Sequence CCTATTCAACAAAAGAATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962686040_962686048 18 Left 962686040 3:137848484-137848506 CCTCAATTCTTTTGTTGAATAGG No data
Right 962686048 3:137848525-137848547 ATTTAGAGTCTTTTCCTTGAGGG No data
962686040_962686047 17 Left 962686040 3:137848484-137848506 CCTCAATTCTTTTGTTGAATAGG No data
Right 962686047 3:137848524-137848546 GATTTAGAGTCTTTTCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962686040 Original CRISPR CCTATTCAACAAAAGAATTG AGG (reversed) Intergenic
No off target data available for this crispr