ID: 962695701

View in Genome Browser
Species Human (GRCh38)
Location 3:137945230-137945252
Sequence ATGTGTGACCAACAGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962695694_962695701 16 Left 962695694 3:137945191-137945213 CCCTCCTGGGACATGAGGTGATT No data
Right 962695701 3:137945230-137945252 ATGTGTGACCAACAGGATGGAGG No data
962695695_962695701 15 Left 962695695 3:137945192-137945214 CCTCCTGGGACATGAGGTGATTG No data
Right 962695701 3:137945230-137945252 ATGTGTGACCAACAGGATGGAGG No data
962695696_962695701 12 Left 962695696 3:137945195-137945217 CCTGGGACATGAGGTGATTGTGC No data
Right 962695701 3:137945230-137945252 ATGTGTGACCAACAGGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962695701 Original CRISPR ATGTGTGACCAACAGGATGG AGG Intergenic
No off target data available for this crispr