ID: 962695808

View in Genome Browser
Species Human (GRCh38)
Location 3:137946044-137946066
Sequence TCTGGAGGGGAGACTTGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962695808_962695816 4 Left 962695808 3:137946044-137946066 CCCTACCAAGTCTCCCCTCCAGA No data
Right 962695816 3:137946071-137946093 ACCTTTCGCTTGCAATGTCCTGG No data
962695808_962695819 23 Left 962695808 3:137946044-137946066 CCCTACCAAGTCTCCCCTCCAGA No data
Right 962695819 3:137946090-137946112 CTGGCTTTCAGATGCTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962695808 Original CRISPR TCTGGAGGGGAGACTTGGTA GGG (reversed) Intergenic