ID: 962695809

View in Genome Browser
Species Human (GRCh38)
Location 3:137946045-137946067
Sequence TTCTGGAGGGGAGACTTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962695809_962695816 3 Left 962695809 3:137946045-137946067 CCTACCAAGTCTCCCCTCCAGAA No data
Right 962695816 3:137946071-137946093 ACCTTTCGCTTGCAATGTCCTGG No data
962695809_962695819 22 Left 962695809 3:137946045-137946067 CCTACCAAGTCTCCCCTCCAGAA No data
Right 962695819 3:137946090-137946112 CTGGCTTTCAGATGCTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962695809 Original CRISPR TTCTGGAGGGGAGACTTGGT AGG (reversed) Intergenic