ID: 962695812

View in Genome Browser
Species Human (GRCh38)
Location 3:137946058-137946080
Sequence AGCGAAAGGTGGCTTCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962695812_962695816 -10 Left 962695812 3:137946058-137946080 CCCTCCAGAAGCCACCTTTCGCT No data
Right 962695816 3:137946071-137946093 ACCTTTCGCTTGCAATGTCCTGG No data
962695812_962695819 9 Left 962695812 3:137946058-137946080 CCCTCCAGAAGCCACCTTTCGCT No data
Right 962695819 3:137946090-137946112 CTGGCTTTCAGATGCTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962695812 Original CRISPR AGCGAAAGGTGGCTTCTGGA GGG (reversed) Intergenic