ID: 962695813

View in Genome Browser
Species Human (GRCh38)
Location 3:137946059-137946081
Sequence AAGCGAAAGGTGGCTTCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962695813_962695819 8 Left 962695813 3:137946059-137946081 CCTCCAGAAGCCACCTTTCGCTT No data
Right 962695819 3:137946090-137946112 CTGGCTTTCAGATGCTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962695813 Original CRISPR AAGCGAAAGGTGGCTTCTGG AGG (reversed) Intergenic