ID: 962695814

View in Genome Browser
Species Human (GRCh38)
Location 3:137946062-137946084
Sequence TGCAAGCGAAAGGTGGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962695814_962695819 5 Left 962695814 3:137946062-137946084 CCAGAAGCCACCTTTCGCTTGCA No data
Right 962695819 3:137946090-137946112 CTGGCTTTCAGATGCTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962695814 Original CRISPR TGCAAGCGAAAGGTGGCTTC TGG (reversed) Intergenic