ID: 962695815

View in Genome Browser
Species Human (GRCh38)
Location 3:137946069-137946091
Sequence AGGACATTGCAAGCGAAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962695815_962695819 -2 Left 962695815 3:137946069-137946091 CCACCTTTCGCTTGCAATGTCCT No data
Right 962695819 3:137946090-137946112 CTGGCTTTCAGATGCTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962695815 Original CRISPR AGGACATTGCAAGCGAAAGG TGG (reversed) Intergenic